Fusarium wilt, caused by Fusarium oxysporum Fo, is one of the most important fungal diseases worldwide. Like other plant pathogens, Fo displays specialized forms in association with its hosts. For example, F. oxysporum f. sp. niveum Fon is the damaging pathogen causing Fusarium wilt disease on watermelon, whereas F. oxysporum f. sp. cubense is the pathogen that infects banana. A rapid and reliable pathogen identification or disease diagnosis is essential for the integrated disease management practices in many crops. In this study, two new primer sets, Fon-1/Fon-2 and FnSc-1/FnSc-2, were developed to differentiate Fon and Fo, respectively. The PCR method using the novel primer sets has high sensitivity to detect Fon when the DNA concentration was as low as 0.01 pg or when the conidia number was as few as 5. In comparison with the published primer set, the Fon-1/Fon-2 primer set, derived from the sequence of OP-M12 random primer-amplified fragment, produced a 174 bp DNA fragment, and was more specific to Fon in Taiwan. In addition, with optimized PCR parameters, the molecular method using the Fon-1/Fon-2 primer set could directly detect Fon even when watermelon samples were collected in its early stage of disease development.
Ying-Hong Lin, Kan-Shu Chen, Jing-Yi Chang, Yu-Ling Wan, Ching-Chi Hsu, Jenn-Wen Huang, Pi-Fang Linda Chang
New Biotechnology
Volume 27, Issue 4, 30 September 2010, Pages 409–418
http://dx.doi.org/10.1016/j.nbt.2010.05.005
Please note that the New Biotecnology is not included in the monitored journal list, so the primer set specific to F. oxysporum f. sp. niveum will not be loaded into the database.
At your convenience, I report here the Fon primer sequences:Fon-1/Fon-2a CGATTAGCGAAGACATTCACAAGACT/ACGGTCAAGAAGATGCAGGGTAAAGGT
If more papers on primers specific to phytopathogens will be published on this journal, I will consider its inclusion in the monitored journal list.
